Study On Plant Disease Resistance Biology Essay

Print   

23 Mar 2015

Disclaimer:
This essay has been written and submitted by students and is not an example of our work. Please click this link to view samples of our professional work witten by our professional essay writers. Any opinions, findings, conclusions or recommendations expressed in this material are those of the authors and do not necessarily reflect the views of EssayCompany.

Plants are exploited as a source of food and shelter by a wide range of parasites, including viruses, bacteria, fungi, nematodes, insects and even other plants. They have evolved mechanisms of antimicrobial defence which are either constitutive or inducible. Plants are resistant to most pathogens in their environment, as they are not host plants for particular pathogen or are host plants, but hold on resistance genes, allowing them to recognize specifically distinct pathogen races (Scheel, 1998).

The development of resistant crops is one of the important goals of the plant sciences. The total annual worldwide crop losses due to plant diseases are $ 220 million (Agrios, 2005). Plants combat various diseases by physical and chemical barriers and also by the activation of a plethora of defence mechanisms. Plants are attacked by a wide variety of pathogens and to combat these potential infections, plants have evolved four types of resistance: non-host, gene-for-gene, systemic acquired and basal.

1.1. Arabidopsis thaliana:

Resistance is generally associated with the deposition of callose, salicylic acid synthesis and accumulation and pathogenesis related proteins during various plant pathogen interactions. Arabidopsis thaliana has been used as a model plant to study plant pathogen interaction. For example, using this plant, it has been discovered that isochorismate pathway is the major source of SA during systemic acquired resistance. Arabidopsis is a small flowering plant and its whole genome has been sequenced and therefore, scientists currently are using it as model plant to understand different biological phenomena in plants. A large collection of transfer (T)-DNA insertion mutants has also been generated. It is annual plant and has a short life cycle of almost 6 weeks. Different mutants are available for most of the genes in Arabidopsis to study different pathways in various plants.

1.2. Plant Disease Resistance:

Recognition of pathogen and signal transduction is a pre requisite for the activation of plant defence mechanisms. Usually, plants need to use hormones for communication between cells and organs. These hormones modulate the process to start signalling and produce an external effect by a series of chemical reactions. SA fulfils likewise an important role in signalling pathways in plants.

Indisputably, during pathogen and herbivorous attack, plants need to recognize the invader to properly defend themselves against various microbes and insects. The primary defence of plants is formed by prefacing physical or chemical barriers, such as the presence of toxic secondary metabolites. However, if this first line defence fails, plants can activate other defence responses. These include physical barriers, such as the strengthening of cell walls and chemical defences, the production of anti-microbial compounds e.g. phytoalexins. Thus, resistance against microbes can be mediated through defences that are constitutively present, or through defence mechanisms that are induced only after invader attack (Van Loon, 2000; Dicke and Van Poecke, 2002). Induced defences can be highly diversified and administered against various types of pathogens, but their modulation seems to involve only a limited number of plant signalling compounds: salicylic acid (SA), jasmonic acid (JA) and ethylene (ET) (Reymond and Farmer, 1998; Pieterse and Van Loon, 1999; Feys and Parker, 2000; Thomma et al., 2001; Kessler and Baldwin, 2002). Other plant hormones, such as abscisic acid, brassinosteroids, auxins and oxylipins, have been reported to play roles in plant defence against pathogens and also insects. (Jameson, 2000; Farmer et al., 2003; Krishna, 2003; Thaler and Bostock, 2004; Mauch-Mani and Mauch, 2005). Auxin is also an important hormone that affects almost all aspects of plant growth and development and if its homeostasis disturbs, plants can become more susceptible to different pathogens as many pathogens can synthesize auxin-like molecules. Loss of the ability to synthesize auxin-like molecules rendered these pathogens less virulent (Robert-Seilaniantz et al., 2007).

1.3. Defence Signaling Pathways:

The signal molecules SA, JA and ET are thought to play key roles in the modulation of plant disease resistance responses. Genetic analyses of mutant and transgenic plants that are affected in the biosynthesis or perception of these compounds have provided enthralling evidence for their role in plant defence against various pathogens. In general, it can be stated that SA-dependent defence is effective against biotrophic pathogens, whereas JA- and ET-dependent defences are important for resistance against necrotrophic pathogens (Dicke and Van Poecke, 2002; Glazebrook, 2005). Pharmacological experiments revealed that exogenous application of these compounds often results in an enhanced level of resistance.

It has formerly been shown that the defence signalling compound SA plays a central role in plant disease resistance, both in the establishment of SAR and the induction of local defence responses in the infected tissue. The central role of this compound in plant defence has been uncovered by the use of transformed plants constitutively expressing the bacterial NahG gene, encoding salicylate hydroxylase, which converts SA into inactive catechol. Tobacco and Arabidopsis NahG plants are unable to accumulate SA and show enhanced disease susceptibility to a broad range of oomycete, fungal, bacterial and viral pathogens (Delaney et al., 1994; Kachroo et al., 2000). Moreover, several recessive Arabidopsis mutants, including eds5, sid2 and pad4, do not show SA accumulation upon pathogen infection.

After pathogen attack and rendering effective resistance against the invader, plants develop an enhanced defensive capacity against further attack. An induced systemic resistance mechanism against pathogens has been well explored: pathogen-induced systemic acquired resistance (SAR) (Ross, 1961).

1.4. Systemic acquired resistance (SAR):

Systemic acquired resistance (SAR) is a mechanism which is induced after pathogen attack and it provides long-term protection against a broad spectrum of pathogens. SAR requires the signal molecule salicylic acid (SA) and it is associated with the accumulation of pathogenesis related proteins. It pertains to an explicit signal transduction pathway that plays an important role in making plants resistant against different pathogens. In SAR, after the formation of a necrotic lesion, either as a part of the hypersensitive response (HR) or as a symptom of disease, the SAR pathway is activated. SAR activation results in the development of a broad-spectrum, systemic resistance (Hunt and Ryals, 1996; Neuenschwander et al., 1996). SAR is associated with the expression of a set of genes called SAR related genes (defence genes) (Ward et al., 1991). When SAR is activated, it decreases the severity of an incompatible response.

1.7. Salicylic Acid and SAR:

Salicylic acid is an important signaling pathway in plant diseases. Its accumulation is required at the site of attack for the activation of systemic acquired resistance. NPR1 (nonexpressor of pathogenesis-related (PR) genes 1) is a SA responsive coactivator. In plants, oxidative thiol modifications were shown to play an important role in modulating the activity of the immune coactivator NPR1 (Dong, 2004). NPR1 functions as a global regulator of defence gene expression. In plant cells, before pathogen attack, conserved cysteines in NPR1 form intermolecular disulphide bonds, resulting in the formation of a cytosolic NPR1 oligomer (Mou et al., 2003). This makes NPR1 transcriptionally inactive as it is excluded from the nucleus and after pathogen attack, SA-mediated redox changes convert NPR1 from oligomer to monomer and it is translocated to the nucleus where it binds to TGA transcription factors and activates pathogenesis related gene expression. Intermolecular disulphide bonds in TGA1 and TGA4 that prevent interaction with NPR1 are disrupted upon SA-induced cellular reduction, allowing these TGAs to form a transcriptionally active complex with NPR1 in the nucleus (Despres et al., 2003). Therefore, it has been identified that NPR1 acts downstream of SA. A low level of S-nitrosylaton increases NPR1 in monomeric form. It also blocks SA accumulation. Consequently, when S-nitrosylation is high, plants become more susceptible to diseases and other stresses.

SA is synthesized by plants in response to challenge by a diverse range of plant pathogens and is essential to the establishment of both local and systemic-acquired resistance as its application induces accumulation of pathogenesis-related (PR) proteins and mutations leading to either reduced SA production or impaired SA perception enhance susceptibility to avirulent and virulent pathogens (Loake and Grant, 2007).

There are two pathways for SA biosynthesis: one is through an enzyme isochorismate synthase and the other is through phenylalanine.

1.5. Nitric Oxide (NO) and Plant Disease Resistance:

Nitric Oxide is an important signaling molecule in plant disease resistance. If we stop NO production or we remove it from the plants, we can compromise disease resistance. Simple structure, high diffusivity and the presence of an unpaired electron make (NO) an ideal signaling molecule within species from every biological kingdom (Arasimowicz and Floryszak-Wieczorek, 2007; Hong et al., 2007). The initiative to uncover various roles of NO in plants is a recent one while its importance in animal biology like in respiration, apoptosis, gene expression, cell motility and blood flow etc. was recognized quite early. NO plays an important role in many cellular processes of plants like respiration, programmed cell death, seed germination, flowering and stomatal closure (Neill et al., 2007). Unlike NO synthases (NOS), which is primarily responsible for NO production in animals, plants have a more complex mechanism of NO production. In plants, nitrate reductase (NR) enzyme which convert nitrate into nitrite and also nitrite into NO is one possible source of NO. An enzyme having NOS like activity in Arabidopsis AtNOS has been found (Crawford, 2006). A T-DNA knockout of this gene showed reduce growth and increased susceptibility against Pst DC 3000. However, ATNOS1 has been shown not to directly produce NO. Therefore, the name of this protein has been changed to Arabidopsis thaliana Nitric Oxide Associated 1(AtNOA1) is proposed (Grennan, 2007).

A key feature of R-mediated resistance is the production of reactive oxygen species (ROS) and the hypersensitive reaction (HR). NO reacts with superoxide (O-) to produce peroxynitrite (ONOO-) (Clarke et al., 2000; Zaninotto et al., 2006). The balanced production of NO and H2O2 during attempted pathogen infection triggers cell death (Wendehenne et al., 2004). HR not only deprives the pathogen of nutrients but also results in the accumulation of SA. Increased SA levels in response to pathogen infection activate PR proteins (markers for the long lasting SAR in the distal tissue against secondary infection). Plants do not have any structural homologues of animal caspases. However, an overexpressor of protease inhibitors like cystain in plants also diminished cell death in plants (Hong, et al, 2007). Interestingly there are number of systems where NO even acts as protectant against ROS (Squadrito and Pryor, 1995). NO also plays a vital role in abiotic stresses and its exogenous application improves plants tolerance against drought and cold (Siddiqui et al, 2010). Moreover, exposure to low levels of NO helps in reducing the destructive effects of heavy metals. (Arasimowicz and Floryszak-Wieczorek, 2007). In 1992, the biological significance of NO was recognized by SCIENCE which named the free radical NO as "Molecule of the Year" (Koshland 1992).

1.6. Role of S-Nitrosylation in Plant Disease Resistance:

S-nitrosylation, a key redox based post translational modification plays an important role in plant disease resistance (Feechan et al., 2005). S-nitrosylation, the covalent attachment of a nitrogen monoxide group to the thiol side chain of cysteine plays an important role in signal transduction pathways (Hess, 2005). This process can modify protein activity, protein localization and protein-protein interaction. The role of specific enzymes in S-Nitrosylation is not discovered but NO sources used for S-nitrosylation are free NO, small-molecule NO donors, peroxynitrite, nitrite and metal NO complexes (Wang et al., 2006). The reaction of NO with an antioxidant glutathione (GSH) results in the formation of S-nitrosoglutathione (GSNO) which acts as mobile reservoir of NO bioactivity (Feechan, 2005). GSH is an important reducing agent in plants which shows tolerance to environmental stresses. Biotin switch technology helped in the identification of S-nitrosylated proteins from cell culture and leaves of Arabidopsis when treated with the NO donor GSNO (Lindermayr, 2005). Proteins involved in stress, metabolism, signaling, redox-regulation and the cyto-skeleton association in plants is found to be S-nitrosylated by biotin switch technology in plants. Among these metabolic enzymes involved in glycolysis and sulphur metabolism, enzymes are also potential targets of S-nitrosylation (Grennan, 2007). An enzyme, formaldehyde dehydrogenase (GS-FDH) isolated from E.coli which exhibits strong reductase activity is involved in GSNO turnover. In plants, an enzyme, S-nitrosoglutathione reductase regulates global S-nitrosylation. It is a key player is plant disease resistance. This enzyme in Arabidopsis thaliana, AtGSNOR1 negatively regulates S-nitrosylation. Elevated levels of S-nitrothiols (SNOs) are found in a T-DNA knock out mutant (atgsnor1-3) as compare to wild type. Furthermore, an over expresser mutant (atgsnor1-1) plants has reduced SNO levels. Accumulation of S-nitrothiols is associated with susceptibility, as the atgsnor1-3 mutant was compromised in all forms of resistance. Molecular analysis revealed that increased S-nitrosylation result in the reduction of both SA biosynthesis and signalling (Feechan, 2005; Arasimowicz and Floryszak-Wieczorek, 2007). Furthermore, S-nitrosylation of SA binding protein (SABP) 3 resulted in inhibition of carbonic anhydrase (CA) activity and ultimately compromised R-gene mediated resistance (Wang et al., 2006).

Two reducing systems, consisting of GSNOR and thioredoxins have been identified so far which play important role in the regulation of S-nitrosylation. GSNOR indirectly regulates S-nitrosylation. Mutations in AtGSNOR1 modulate the level of S-nitrosylation (Feechan et al., 2005). A loss of function mutant, atgsnor1-3 increases global S-nitrosylation while a mutation that results in over-expression of AtGSNOR1 leads to reduced global S-nitrosylation.

1.8. Thioredoxins:

In plants, there are certain enzymatic pathways which remove the oxidative thiol modifications. One reducing system, consisting of thioredoxin (TRX) and thioredoxin reductase, has attracted particular attention because of its involvement in many disorders and diseases. Thioredoxin (TRX) is a small (12kDa), multifunctional protein with a redox active dithiol/disulfide site sequence and maintains cellular redox homeostasis. S-nitrosylation of NPR1 by S-nitrosoglutathione (GSNO) at cysteine-156 facilitates its oligomerization and it is sequestered in the cytoplasm as an oligomer through intermolecular disulfide bonds and this SA-induced NPR1 oligomer-to-monomer reaction is catalyzed by thioredoxins (TRXs) (Tada et al., 2008). Particularly, cytosolic TRXs in plants were shown to be required for the SA-induced reduction of the NPR1 coactivator from oligomer to active monomer (Tada et al., 2008). TRX5 is involved in systemic acquired resistance and in effector triggered immunity and it is highly pathogen inducible. Mutations in both NPR1 and TRX compromise NPR1-mediated disease resistance. Thioredoxins cause reduction in the nucleus by causing reduction in the intermolecular disulphide bonds. After causing this reduction, they themselves become deactivated. Then thioredoxin reductase reactivates them by using the reducing power of NADPH. In their reduced state, thioredoxins are able to provide reducing power to numerous target proteins like peroxidases or reductases (carmel-Harel and Storz, 2000; Nordberg and Arner, 2001).

Figure 1. Biochemical mechanisms of protein denitrosylation.

(a) Mechanisms of denitrosylation by thioredoxin (Trx) and S-nitrosoglutathione reductase (GSNOR). (b) Alternative proposed mechanisms of Trx-mediated denitrosylation.

Thioredoxins perform the following functions:

Denitrosylation

Regulation and

Reduction.

Thioredoxins themselves become S-nitrosylated and cause denitrosylation of the target proteins using the reducing power of NADPH (Fig.1). Therefore they play an important role in defence. Thioredoxins and GSNOR have the same outcome i.e. they denitrosylate the targeted proteins but GSNOR causes this denitrosylation indirectly and thioredoxins do this more directly.

1.9. Nuclear thioredoxins:

In yeast, nuclear thioredoxin was shown to inactivate the Yap1 transcription factor by reducing its intermolecular disulphide bond, resulting in nuclear export (Izawa et al., 1999). In plants, nuclear thioredoxin 1 and 2 have been identified. Thioredoxins function in their reductive phases, defence proteins such as NPR1 appears to activate target genes (PR genes) only during the reductive phases (Mou et al., 2003; Tada et al., 2008; Spoel et al., 2009) and reduction always occurs in the nucleus. Transcription factors start binding with DNA in the nucleus in the reducing state. We can say that every process in the nucleus occurs when reducing state prevails. That's why scientists, currently are paying particular attention towards nuclear thioredoxins. As they are included in thioredoxin family, they perform the same functions as thioredoxins.

Aims and Objectives:

How does GSNO reduce SA level after pathogen infection?

We will check the expression of genes integral to SA biosynthesis including; ICS1, EDS5, PAD4 and PBS3 in different mutants, gsnor1-1 and gsnor1-3 which are dysregulated in the biosynthesis of this molecule. Global S-nitrosylation levels are decreased in gsnor1-1 but increased in gsnor1-3 in SA biosynthesis. It is now well established that increased s-nitrosylation blocks SA accumulation. However, the underlying mechanism remains to be determined.

There could be several hypotheses for why SA accumulation is low in the presence of high levels of S-nitrosylation: (1) S-nitrosylation might suppress the above mentioned genes that encode the enzymes for SA synthesis; (2) S-nitrosylation could increase the mRNA turnover of genes encoding enzymes of SA synthesis; SA is synthesized but it turns over quickly and One or more enzymes of SA biosynthesis are post translationally modified, blunting their activity in the biosynthesis of this molecule.

First it will need to design the primers of above mentioned genes and then check their expression through RT-PCR.

A mutant (nrx1) has been made using T-DNA insertion in NRX1 (Nucleoredoxin1) to see its role in defence. So we will see what is the interaction between nrx1 and gsnor1-3 and what role do they play in disease signaling? As we know that nrx1 mutant has low levels of S-nitrosylation but gsnor1-3 mutant has high levels of S-nitrosylation. So we will make a double mutant (gsnor1-3 X nrx1) to see whether they play role in the same signaling pathway or not. We will also cross nrx1 mutant with pad4, sid2, NahG and gsnor1-3 to further confirm the role of nrx1 mutant in defence.

We will also treat nrx1 mutant with hormones like SA, jasmonic acid, auxin and ACC to further identify its role in any other signaling pathway.

Nuclear thioredoxins play role in the regulation of S-nitrosylation. It has been found that animal thioredoxins can remove S-nitrosylation then most probably plant nuclear thioredoxins may also have role in denitrosylation.

A mutant in nuclear thioredoxin may look like gsnor mutant. If they are involved in denitrosylation, then mutating both of them may cause higher S-nitrosylation. We will do this through infection experiments, gene expression and expression of thioredoxin itself by using different thioredoxin mutants such as nrx1 and nrx2. In the later stages, we would also find how many proteins are S-nitrosylated in these mutants. We will test all the mutants by looking pathogen growth and gene expression.

Part II. Materials and Methods

All chemicals were purchased from Sigma (Sigma-Aldrich, UK)

2.1. Materials:

2.1.1. Bacteria:

Pseudomonas syringae pv tomato strain DC 3000 (Whalen et al., 1991)

Psudomonas syringae pv maculicola strain ES4326.

2.1.2. Plant Material and Growth conditions:

Arabidopsis plants, loss of function mutant atgsnor 1-3, npr1 and gain of function mutant atgsnor1-1(24-2 and 24-34) along with some thioredoxin mutants (nrx1, nrx2,) of Col-0 background were grown as six per pot at 20° C in a pathogen free chambers under long day conditions (16 light/8h darkness).The potting medium consists of peat moss, vermiculite and sand with 4:1:1 respectively.

2.1.3. Media and Additives:

2.1.3.1. Bacterial Media:

2.1.3.2. KB Medium:

Protease peptone 20g/l, glycerol 10ml/l, K2HPO4 1.5g/l, agar 15g/l, when cool, add 1M MgSO4 5ml/l.

2.1.3.3 Antibiotics:

Kanamycin (1000x): 50 mg/ml in H2O

Rifampicin (1000x): 100mg/ml in DMSO

Stock solution stored at -20° C

2.1.4. Bacterial liquid culture for pathogenicity assay:

Following procedure used to make bacterial culture and to inoculate plants:

Procedure:

Pick a relatively generous amount of inoculum of the chosen bacterial strain from the stock plate and inoculate 5ml of King's broth (KB) medium. Incubate overnight at 28° C. Room temperature will be sufficient if incubator is not available. (The inoculum should be generous, as Pseudomonas syringae does not grow as fast as E. coli, and the culture should be quite dense after overnight incubation (OD 600=1.0 or higher)). In my experiments, I used OD 600= 0.02-0.0002.

The following day, pallet the cells and resuspend them in an appropriate volume of 10mM MgSO4. (Adjust the concentration of the bacterial suspension according to the purpose of the experiment and inoculation techniques used).

Use the following method to inoculate plants.

Draw the bacterial suspension into a 1cc syringe and use it to force the suspension on the abaxial surface of the leaf.

Hold the index finger of one hand against the adaxial surface of the leaf, use the other hand to press the syringe against the abaxial side at the corresponding position, and depress the plunger.

2.1.4.1. Pathogenicity susceptibility Assay (EDS):

Pseudomonas syringae pv maculicola strain ES4326 was grown in KB medium supplemented with 100mg/l streptomycin and incubated in the 28 degree shaker for 24 hours. Four weeks old plants (col-0, nrx1, nrx2 and npr1) were infected with a Psm ES4326 suspension (OD 600= 0.0002) in 10mM MgSO4 on the abaxial side of the leaf using a 1ml syringe (Cao et al., 1994). Three leaves per plant and three plants per line were infected. After five days, plants were examined for disease symptoms by counting the colonies formed by the pathogen.

2.1.4.2. Pathogenicity Resistance Assay (SA induced resistance):

Pseudomonas syringae pv maculicola strain ES4326 was grown in KB medium supplemented with 100mg/l streptomycin and incubated in the 28 degree shaker for 24 hours. Four weeks old col-0, nrx1, nrx2 and npr1 were sprayed with 0.5mM SA solution and water (as control). Plants were also infected with Psm ES4326 suspension (OD 600= 0.002) after 2 days using the same procedure as mentioned above and were examined for disease symptoms 3 days of post inoculation through colony count method.

Molecular work:

Pseudomonas syringae pv tomato DC3000 (Whalen et al., 1991) was grown in KB medium supplemented with 50mg/l rifampicin. Four weeks old plants were infected with a Pst DC3000 suspension (OD 600= 0.02) in 10mM MgSO4 on the abaxial side of the leaf using a 1ml syringe (Cao et al., 1994). Three leaves per plant and three plants per line were infected by using different time points. Then plants were also infiltrated with the same pathogen but with lower OD 600= 0.0002 at different time course. After the specific time course, tissues were collected in the liquid nitrogen and were kept at -80° C. then their RNA was extracted and normal RT PCR was done to check the expression of target genes.

2.1.5. Nucleic Acid Related Methods:

2.1.5.1. DNA Isolation:

100mg plant material was ground in C-TAB extraction buffer for DNA isolation and transferred into 1.5 ml microfuge tube. Extract was incubated at 65°C for at least 30 mins. 300μl of Chloroform was added and mixed by inverting the tube. The samples were centrifuged at 15000rpm for 2 minutes. Supernatant was transferred to a new Eppendorf tube containing equal volume (300μl) isopropanol. The samples were thoroughly mixed and centrifuged at15000rpm for 5 minutes. Supernatant was discarded and pellet was washed with 70% ice cold ethanol and centrifuged at 15000rpm for 2 mins. Finally dry pellet was re-suspended in 100μl H2O or TE Buffer.

2.1.5.2. RNA Extraction:

RNeasy Plant Mini Kit (QIAGEN) was used to extract RNA. Its procedure is as follows:

Plant tissues collected in liquid nitrogen were ground first and then almost 100mg powder was added in 1.5ml microcentrifuge tube containing 450μl RLT buffer along with 10μl mercaptoethanol and was mixed thoroughly. The tissue was incubated at 56°C for 1-3minutes. The lysate was then transferred to a QIAshredder spin column (lilac) placed in 2ml collection tube and centrifuged for 2min at full speed. Supernatant was carefully transferred to an RNeasy spin column (pink) placed in 2ml collection tube supplied in kit. Then 0.5 volume of 100% ethanol was added in the cleared lysate and mixed immediately by pipetting and centrifugation done for 15seconds at full speed. The flow through was discarded after centrifugation. 700μl RW1 buffer was added in RNeasy spin column and again centrifugation done for 15seconds at full speed and flow through was discarded. 500μl buffer RPE was added in the column and centrifugation done for 15 seconds at full speed. RPE buffer was again added in the column after discarding the flow through but this time centrifugation was done for 2min at full speed to wash the spin column membrane. As the long centrifugation dries the spin column membrane, ensuring that no ethanol is carried over during RNA elusion. Residual ethanol may interfere with downstream reactions. After centrifugation RNeasy spin column was carefully removed from the collection tube so that column did not contact the flow through. Otherwise carryover of ethanol would occur. Then the RNeasy spin column was placed in a new 2ml collection tube supplied in the kit and the flow through was discarded along with the old collection tube and centrifugation was done at full speed for 1min. RNeasy spin column was then placed in a new 1.5ml collection tube (supplied) 30-50μl RNase free water was directly added in the spin column and centrifugation done for 1min at full speed. RNA concentration was finally measured using nanodrop.

2.1.5.3. cDNA Synthesis:

Table 1. Recipe for cDNA synthesis.

cDNA reagents Concentration Volume

Buffer (10x) 10x 2 µl

dNTPs 5 mM 2 µl

Oligo DT 25µM 0.8µl

RNase inhibitor 0.25µl

Omniscript RT 1µl

Total 6.05µl

Omniscript RT (QIAgen) kit was used to synthesize cDNA. First of all RNA was denatured at 65° C for 10 minutes. Then master mix containing the above reagents was added in the denatured RNA along with the measured quantity of water and the reaction mixture was incubated first at 37°C for 1 hour and then at 72°C for 5 minutes.

2.1.5.4. Primer Designing:

Following primers were used to check the expression of defence genes in different genomes. Table 2. Primers used for genetic analysis with their name and sequence.

genoppID

Size

Forward sequence

Reverse sequence

Tm

1-ICS1/SID2

At1g74710.1f235r400

703

GGTGCACCAGCTTTTATCGGAAAC

TGAGAACCCCTTATCCCCCATACAA

64/64

2- EDS5/SID1

At4g39030.1f35r232

410

CTGCGTCAGAATTGATCGGGAA

CAGCCCAAGGACCGAATAATCTTG

63/63

3- PAD4

At3g52430.1f91r442

567

ATGACATCGCCGGGATTACATACG

GATGTTCCTCGGTGTTTTGAGTTGC

64/64

4- PBS3

At5g13320.1f244r294

737

CGACTTGCCTCTCGTTTCAACAAC

GCAAGGCTTTCCCTGACTTAATGC

64/64

5- NRX1

At1g60420.1f157r613

328

TTCTCGGCCCTGATGGAAAAACC

GCTTCATTCCGCTCCTTTATCTGCT

65/65

6- NRX2

At4g31240.1f146r23

410

CACGAGTCCCGAAATTACGTTGTTG

TCCGTGAACGGAAAACTCCTTGA

64/64

2.1.5.5. Normal Reverse Transcriptase PCR (RT-PCR):

The cDNA obtained from col-0, fdh1-1(24-2, 24-34), fdh/gsnor1-3, nrx1, nrx2, nrx1/2 and npr1 were used as template in PCR amplification using primers given in Table 2.

Table 3. Recipe for normal reverse transcriptase PCR (RT-PCR).

PCR reagent Concentration Volume

Template 1 µl

dNTPs 2.5 mM 2 µl

Buffer 10x 2.5 µl

MgCl2 25 mM 2.5 µl

Forward primer 10µM 1 µl

Reverse primer 10µM 1 µl

Taq Polymerase (Home made) 5 U 0.5 µl

Double distilled H2O 14.5 µl

Total Volume 25 µl

Table 4. PCR Profile.

1) Initial denaturing temperature 94oC 1 minutes

2) Denaturing temperature 94oC 30 seconds

3) Annealing temperature 54-62oC 30 seconds

4) Extension temperature 72oC 30 seconds

5) 25-30 cycles from step 2 to step 4

6) Final extension temperature 72oC 7 minutes

7) 4oC forever

The amplified products were analyzed by electrophoresis on 1.2% agarose gel along with 100bp DNA ladder.

2.1.5.6. Normal Reverse Transcriptase PCR (RT-PCR) with Crimson Taq:

Table 5. Recipe for normal RT-PCR with crimson taq.

PCR reagent Concentration Volume

Template 1 µl

dNTPs 2.5 mM 2 µl

Crimson Taq Buffer 5x 5 µl

Forward primer 10µM 1 µl

Reverse primer 10µM 1 µl

Crimson Taq Polymerase 0.125 µl

Double distilled H2O 14.875 µl

Total Volume 25 µl

Table 6. PCR Profile for Crimson Taq.

1) Initial denaturing temperature 95oC 30 seconds

2) Denaturing temperature 95oC 30 seconds

3) Annealing temperature 54-62oC 30 seconds

4) Extension temperature 68oC 30 seconds

5) 25-30 cycles from step 2 to step 4

6) Final extension temperature 68oC 5 minutes

7) 4oC forever

The amplified products were analyzed by electrophoresis on 1.2% agarose gel along with 100bp DNA ladder.

Part III. Results and Discussion

Results:

3.1.1 SA synthesis gene expression analysis in gsnor1-1 and 1-3 mutants:

Figure 2. Expression of genes integral to SA synthesis in gsnor1-1 and 1-3 mutants inoculated with PstDC3000 at OD600= 0.02.

Wild type Col-0, gsnor1-1 and gsnor1-3 mutants were treated with Pseudomonas syringae pv tomato strain DC3000 (Pst DC3000) through pressure infiltration at OD600= 0.02. RT-PCR was performed on the samples to check the expression of SA synthesis genes by using primers of all the genes like ICS1, EDS5, PAD4, and PBS3. PR1 primer was used as negative control. According to the results, there was strong induction of all the genes because there was very less or no induction at 0hrs in wild type as well as in other genotypes and it increased with higher time points. (Figure 2).

But these results did not give the clear difference in the expression of all the SA synthesis genes with the pathogen concentration at OD600= 0.02 at different time points. Therefore, we did the same experiment with a lower pathogen concentration.

Figure 3. Expression of genes integral to SA synthesis in gsnor1-1 and 1-3 mutants inoculated with PstDC3000 at OD600= 0.0002.

Wild type Col-0, gsnor1-1 and gsnor1-3 plants were treated with Pst Dc3000 at OD600= 0.0002. They were checked for the expression of all the defence genes through RT-PCR. According to the results obtained from this experiment, all the SA synthesis genes were induced by infection in Col-0 and gsnor1-1 plants. However, induction of both the SA synthesis genes and the SA-responsive PR-1 gene were strongly reduced in gsnor1-3 plants. These data suggest that high levels of GSNO inhibit SA synthesis through transcriptional suppression. Among all the genes, ICS1/SID2 and EDS5 exhibited the clearest difference in expression in gsnor1-3 mutant as compared to Col-0 plants (Figure 3).

Therefore, it was found that among all the SA synthesis genes, because ICS1/SID2 and EDS5 genes give the clearest difference, I will select them for further investigation.

3.1.2. Identification of Defence Related ICS1 Promoter Motifs

Figure 4. ICS1 promoter with important sequence motifs.

Figure 5. pGreen vector fused with Luciferase gene.

3.1.2. NRX (nucleoredoxin) knockout and expression analysis:

Figure 6. NRX1 and NRX2 knock out and expression analysis.

RT-PCR was performed on the selected samples to confirm the T-DNA insertion in NRX1 and NRX2 genes by using their primers. There was no expression of NRX1 and NRX2 in nrx1 and nrx2 mutants, respectively, indicating the proper T-DNA insertion. But it has been found from the results that NRX1 gene is still inducible by the pathogen because its expression was very low at 0hrs in col-0 but it increased with the higher time points. (Figure 6).

3.1.3. Disease phenotypes of nrx1 & nrx2 (EDS):

Figure 7. Disease phenotype of nrx1 and nrx2 mutants

Wild type Col-0, nrx1, nrx2 and npr1 were treated with Psm at OD600= 0.0002 for 5 days. Number of colonies (formed by bacteria) counted 5 days of post inoculation, indicated that there was no much difference among nrx1 and nrx2 mutants in EDS as growth of the pathogen was almost same in both mutants. The data suggested that both mutants don't seem to be more susceptible rather they seem to be more resistant. (Figure 7). That's why we did EDR (enhanced disease resistance) to further confirm the results.

3.1.4. Enhanced disease resistance (EDR):

Figure 8. SA treatment (EDR) of nrx1 and nrx2 mutants

All the plants were first treated with 0.5mM SA for 24hrs. They were also infected with Psm at OD600= 0.002 and analyzed after three days. I found from the data that nrx1 mutant is already resistant as the pathogen growth was almost same in this mutant before and after SA treatment and it was resistant as compared to wild type Col-0 in which pathogen growth was quite higher than nrx1 before SA treatment. It means SA signalling is already on in nrx1 that's why we are more interested in nrx1 because it gave more obvious phenotype than nrx2 and nrx1/2. The nrx1 and nrx1/2 (double mutant) gave almost the same phenotype that suggested that nrx2 mutation does not really affect the nrx1 mutation. (Figure 8).

The results from the infection experiment indicate the SA signaling is already ON in nrx1 mutants. Therefore, I have looked at SA-dependent synthesis and defence gene expression in this mutant.

3.1.5. NRX1 defence gene expression analysis:

Figure 9. SA synthesis gene expression analysis in nrx1 and nrx2 mutants

As NRX1 is induced by the pathogen, we did defence gene expression analysis in nrx1 mutant to confirm its role in plant defence system. Wild type Col-0 and nrx1 mutants were treated with Pseudomonas syringae pv maculicola through pressure infiltration and tissue harvested at 0, 12 and 24hrs time points. RT-PCR was done on these samples to check the expression of all the defence genes in nrx1 mutant by using their primers. The results from nrx1 mutant were compared with wild type Col-0 and it was found that almost all the defence genes were already on in nrx1 mutant as they gave expression at 0hrs in this mutant i.e. without pathogen treatment. On the contrast, in case of wild type, there was almost no or very less expression of all these genes at 0hrs and the expression increased with higher time points. (Figure 9).

On the basis of the above results, I found that nucleoredoxin (NRX) 1 and 2 are very important in Arabidopsis. NRX1 is more important as it inhibits the defence genes like ICS1, PAD4, EDS5 and PBS3 etc. NRX1 gene is induced in wild type that means it does not want to activate the defence for a very long period because high level of SA is toxic to plants as during the defence, SA is accumulated in plants and activates the defence against the invaders. So there is a loop i.e. once defence is activated it is stopped after certain period of time by the activation of NRX1 gene in wild type.

3.1.6. Hormone treatment of nucleoredoxin mutants:

Wild type Col-0, nrx1/2 and npr1 were treated with 0.5mM SA, 50µM auxin, 10µM JA and 100µM ACC for 0 and 24hrs through pressure infiltration. The data indicated that expression of NRX1 and 2 genes have been suppressed by almost all the hormones after 24hrs. It means these genes are down regulated by these hormones. (Figure 10).

Figure 10. Hormone treatment of nucleoredoxin mutants.

Future Plans:

Making promoter deletion series.

Checking the expression of ICS1 in different transcription factor mutants. So we can see how the transcription factors regulate the gene expression.

Testing the binding of TGA and WRKY transcription factors to the promoter by using gel shift method.

Measuring SA level in nrx mutants because we know that there is higher expression levels of SA synthesis genes in nrx mutants.

We need to complement both nrx mutants. We can add a tag (GFP) to NRX gene to find its location.

We also need to find out the activity of NRX1 and 2 proteins. We will produce the recombinant proteins in Ecoli. We can test the activity by the following ways;

If these proteins reduce the disulphide bond. We will do this by Insulin Turbidity Assay.

If NRX1 and 2 can remove nitric oxide i.e. can they denitrosylate the proteins. We will find it by SNO-BSA by adding NRX1 and 2 in it.

We can also do the transformation of plants with nrx1 and 2 mutants. We can mutate the thioredoxin modules in NRX1 and 2 to find out which domain is more important.

We can find out the active cystine sites after performing all above mentioned experiments.

Finally, by mutating the second cystine from nucleoredoxins, we could actually find what they reduce in the target proteins.

PhD Schedule

References:

Agrios, G. N. (2005). Plant pathology, 5th Ed. Elsevier Academic Press, London.

Arasimowicz, M. and Floryszak-Wieczorek, J. (2007). Nitric oxide as a bioactive signaling molecule in plant stress responses. Plant Sci 172: 876-887.

Benhar, M., Forrester, M. T. and Stamler, J. S. (2009). Nat. Rev. Mol. Cell Biol. 10, 721-732.

Carmel-Harel, O. and Storz, G. (2000). Roles of the glutathione- and thioredoxin-dependent reduction systems in the Escherichia coli and Saccharomyces cerevisiae responses to oxidative stress. Annu. Rev. Microbiol. 54: 439-461.

Clarke A., Desikan, R., Hurst, DR., Hancock, T.J. and Neill, J.S. (2000). NO way back: nitric oxide and programmed cell death in Arabidopsis thaliana suspension cultures. Plant J 24(5):66-677.

Crawford, N. M. (2006). Mechanisms for nitric oxide synthesis in plants. J Exp Bot 57: 471-478.

Delaney, T.P., Uknes, S., Vernooij, B., Friedrich, l.., Weymann, K., Negrotto, D., Gaffney, T., Gut-Rella, M., Kessmann, H., Ward, E. and Ryals, J. (1994). A central role of salicylic acid in plant disease resistance. Science 266: 1247-1250.

Despre´s, C., Chubak, C., Rochon, A., Clark, R., Bethune, T., Desveaux, D. and Fobert, P.R. (2003). The Arabidopsis NPR1 disease resistance protein is a novel cofactor that confers redox regulation of DNA binding activity to the basic domain ⁄ leucine zipper transcription factor TGA1. Plant Cell 15: 2181-2191.

Dicke, M. and Van Poecke, R.M.P. (2002). Signalling in plant-insect interactions: Signal transduction in direct and indirect plant defence. In Plant Signal Transduction: Frontiers in Molecular Biology, D. Scheel and C. Wasternack, eds,. (Oxford: Oxford University Press), pp. 289-316.

Dong, X. (2004). NPR1, all things considered. Current opinion in plant Biology 7: 547-552.

Farmer, E.E., Almeras, E. and Krishnamurthy, V. (2003). Jasmonates and related oxylipins in plant responses to pathogenesis and herbivory. Curr. Opin. Plant Biol. 6: 372-378.

Feechan, A., Kwon, E., Yun, B. W., Wang, Y., Pallas, A.J. and Loak, J. G. (2005). A central role for s-nitrosothiols in plant disease resistance. PNAS, 102:8054-8059.

Feys, B.J. and Parker, J.E. (2000). Interplay of signaling pathways in plant disease resistance. Trends Genet.16: 449-455.

Glazebrook, J. (2005). Contrasting mechanisms of defence against biotrophic and necrotrophic pathogens. Annu. Rev. Phytopathol. 43: 205-227.

Grennan, K.A. (2007). Protein S-Nitrosylation: Potential Targets and Roles in Signal Transduction. Plant Physiol 144:1237-1239.

Hess, D.T., Matsumoto, A., Kim, S.O., Marshall, H E. and Stamler, J.S. (2005). Protein S- nitrosylation: purview and parameters. Nat Rev Mol Cell Biol 6:150-66.

Hong, K, J., Wook, B.Y., Kang, J.G., Raja, M.U., Kwon, E., Sorhagen, K., Chu, C., Wang, Y. and Loake, G.J. (2007). Nitric oxide function and signaling in plant disease resistance. J Exp Bot: 1-8.

Hunt, M. and Ryals, J. (1996). Systemic acquired resistance signal transduction. Crit. Rev. Plant Sci. 15, 583-606.

Izawa, S., Maeda, K., Sugiyama, K., Mano, J., Inoue, Y. and Kimura, A. (1999). Thioredoxin deficiency causes the constitutive activation of Yap1, an AP-1-like transcription factor in Sacchromyces cerevisiae. Journal of Biological Chemistry 274: 28459-28465.

Jameson, P.E. (2000). Cytokinins and auxins in plant-pathogen interactions - an overview. J. Plant Growth Regul. 32: 369-380.

Kachroo, P., Yoshioka, K., Shah, J., Dooner, K.D. and Klessig, D.F. (2000). Resistance to turnip crinkle virus in Arabidopsis is regulated by two host genes and is salicylic acid dependent but NPR1, ethylene, and jasmonate independent. Plant Cell 12: 677-690.

Kessler, A. and Baldwin, I.T. (2002). Plant responses to insect herbivory: The emerging molecular analysis. Annu. Rev. Plant Biol. 53: 299-328.

Koshland, D.E. (1992). The molecule of the year. Sci 258:1861.

Krishna, P. (2003). Brassinosteroid-mediated stress responses. J. Plant Growth Regul. 22: 289-297.

Lindermayr, C., Saalbach, G. and Durner, J. (2005). Proteomic identification of S-nitrosylated proteins in Arabidopsis. Plant Physiol 137: 921-930.

Loak, J.G. and Grant, M. (2007). Salicylic acid in plant defence-the players and protagonists. Plant Biol, 10:466-472.

Mauch-Mani, B., and Slusarenko, A.J. (1996). Production of salicylic acid precursors is a major function of phenylalanine ammonia-lyase in the resistance of Arabidopsis to Peronospofa parasitica. Plant Cell 8, 203-212.

Mauch-Mani, B., and Mauch, F. (2005). The role of abscisic acid in plant-pathogen interactions. Curr. Opin. Plant Biol. 8: 409-414.

Mou, Z., Fan, W. and Dong, X. (2003). Inducers of plant systemic acquired resistance regulate NPR1 function through redox changes. Cell 113: 935-944.

Neill, S., Bright, J., Desikan, R., Hancock, J., Harrison, J. and Wilson, I. (2007). Nitric oxide evolution and perception.J Exp Bot (in press).

Neuenschwander, U., Lawton, K. and Ryals, J. (1996). Systemic acquired resistance. In Plant-Microbe Interactions, Vol. 1, G. Stacey and N.T. Keen, eds (New York: Chapman and Hall), pp. 81-106.

Nordberg, J. and Arner, E.S. (2001). Reactive oxygen species, antioxidants, and the mammalian thioredoxin system. Free Radic. Biol. Med. 31: 1287-1312.

Pieterse, C.M.J. and Van Loon, L.C. (1999). Salicylic acid-independent plant defence pathways. Trends Plant Sci. 4: 52-58.

Reymond, P. and Farmer, E.E. (1998). Jasmonate and salicylate as global signals for defence gene expression. Curr.m Opin. Plant Biol. 1: 404-411.

Robert-Seilaniantz, A., Navarro, L., Bari, R. and Jones, J.D.G. (2007). Curr. Opin. Plant Biol. 10, 372-379.

Ross, A.F. (1961). Systemic acquired resistance induced by localized virus infections in plants. Virology 14: 340-358.

Scheel, D. (1998). Resistance response physiology and signal transduction. Curr. Opin. Plant Biol., 1, 305-310.

Manzer H., Siddiqui, Mohamed, H., Al-Whaibi & Mohammed, O. Basalah. (2010). Role of nitric oxide in tolerance of plants to abiotic stress. Protoplasma. DOI 10.1007/s00709-010-0206-9.

Squadrito, G.L. and Pryor, W.A. (1995). The formation of peroxynitrite in vivo from nitric oxide and superoxide. Chemio-Biol al Interact 96:203-206.

Tada, Y., Spoel, S.H., Pajerowska-Mukhtar, K., Mou, Z., Song, J. and Dong, X. (2008). S-nitrosylation and thioredoxins regulate conformational changes of NPR1 in plant innate immunity. Science 321: 952-956.

Thaler, J.S. and Bostock, R.M. (2004). Interactions between abscisic-acid-mediated responses and plant resistance to pathogens and insects. Ecology 85: 48-58.

Thomma, B.P.H.J., Penninckx, I.A.M.A., Cammue, B.P.A. and Broekaert, W.F. (2001). The complexity of disease signaling in Arabidopsis. Curr. Opin. Immunol. 13: 63-68.

Uknes, S., Mauch-Mani, B., Moyer, M., Potter, S., Williams, S., Dincher, S., Chandler, D., Slusarenko, A., Ward, E. and Ryals, J. (1992). Acquired resistance in Arabidopsis. Plant Cell4, 645-656.

Van Loon, L.C. (2000). Systemic induced resistance. In Mechanisms of Resistance to Plant Diseases, A.J. Slusarenko, R.S.S. Fraser, and L.C. Van Loon, eds (Dordrecht, The Netherlands: Kluwer Academic Publishers), pp. 521-574.

Van Poecke, R.M.P. and Dicke, M. (2002). Induced parasitoid attraction by Arabidopsis thaliana: Involvement of the octadecanoid and salicylic acid pathway. J. Exp. Bot. 53: 1793-1799.

Wang, Y., Wook, B.Y., Kwon, E., Hong, J.K., Yoon, J. and Loake, J.G. (2006). S-nitrosylation: an emerging redox- based post-translational modification in plants. J Exp Bot 57: 1777-1784.

Wendehenne, D., Durner. J. and Klessig, D.F. (2004). Nitric oxide: a new player in plant signaling and defence responses. Curr Opin Plant Biol 7(4):449-55.

Whalen, M., Innes, R., Bent, A. and Staskawicz, B. (1991). Identification of Pseudomonas syringae, a pathogen of Arabidopsis and a bacterial locus determining avirulence on both Arabidopsis and soybean. Plant Cell 3: 49-59.

Ward, E.R., Uknes, S.J., Williams, S.C., Dincher, S.S., Wiederhold, D.L., Alexander, D.C., Ahl-Goy, P., Métraux, J.-P. and Ryals, J.A. (1991). Coordinate gene activity in response to agents that induce systemic acquired resistance. Plant Cell 3, 1085-1094.

Zaninotto, F., La Camera, S., Polverari, A. and Delledonne, M. (2006).Cross talk between reactive nitrogen and oxygen species during the hypersensitive response. Plant Physiol 141: 379-383.

Contents

Part I. Introduction 1

1.1. Arabidopsis thaliana: 1

1.2. Plant Disease Resistance: 2

1.3. Defence Signaling Pathways: 3

1.4. Systemic acquired resistance (SAR): 4

1.7. Salicylic Acid and SAR: 4

1.5. Nitric Oxide (NO) and Plant Disease Resistance: 6

1.6. Role of S-Nitrosylation in Plant Disease Resistance: 7

1.8. Thioredoxins: 9

1.9. Nuclear thioredoxins: 10

Part II. Materials and Methods 13

2.1. Materials: 13

2.1.1. Bacteria: 13

2.1.2. Plant Material and Growth conditions: 13

2.1.3. Media and Additives: 13

2.1.3.1. Bacterial Media: 13

2.1.3.2. KB Medium: 13

2.1.3.3 Antibiotics: 14

2.1.4. Bacterial liquid culture for pathogenicity assay: 14

2.1.4.1. Pathogenicity susceptibility Assay (EDS): 15

2.1.4.2. Pathogenicity Resistance Assay (SA induced resistance): 15

2.1.5. Nucleic Acid Related Methods: 16

2.1.5.1. DNA Isolation: 16

2.1.5.2. RNA Extraction: 17

2.1.5.3. cDNA Synthesis: 18

2.1.5.4. Primer Designing: 18

2.1.5.6. Normal Reverse Transcriptase PCR (RT-PCR) with Crimson Taq: 19

Part III. Results and Discussion 20

3.1.1 SA synthesis gene expression analysis in gsnor1-1 and 1-3 mutants: 21

3.1.2. NRX (nucleoredoxin) knockout and expression analysis: 24

3.1.3. Disease phenotypes of nrx1 & nrx2 (EDS): 24

Future Plans: 29

PhD Schedule 31

31



rev

Our Service Portfolio

jb

Want To Place An Order Quickly?

Then shoot us a message on Whatsapp, WeChat or Gmail. We are available 24/7 to assist you.

whatsapp

Do not panic, you are at the right place

jb

Visit Our essay writting help page to get all the details and guidence on availing our assiatance service.

Get 20% Discount, Now
£19 £14/ Per Page
14 days delivery time

Our writting assistance service is undoubtedly one of the most affordable writting assistance services and we have highly qualified professionls to help you with your work. So what are you waiting for, click below to order now.

Get An Instant Quote

ORDER TODAY!

Our experts are ready to assist you, call us to get a free quote or order now to get succeed in your academics writing.

Get a Free Quote Order Now