Molecular Interaction Of E Coli

Published Date: 02 Nov 2017

Sanidhi Gupta, Somreeta Deb, Camellia Paul and Subramanian Babu

School of Bio Sciences and Technology,VIT University ,Vellore-632014,Tamil Nadu

Abstract

Interaction between an enteropathogenic clinical isolate of E. coli and chickpea sprouts was studied with avirulent K 12 strain in comparison. E. coli were induced to colonize by repeated co-incubation with chickpea sprouts for five days. Expression of E. coli intimin gene involved in animal as well as plant host colonization and virulence was studied by reverse transcription PCR. Expression of this gene was high in pathogenic E. coli when co-incubated with chickpea sprouts.

Introduction

Consumption of sprouts has been identified as one of the potential cause for food-borne illness due to pathogen growth during sprouting process. Pathogens present either in the interior of the seed or on surface are favored by sprouting for multiplication (NACMCF, 1999). Although contaminated seeds are the major vehicle for sprout-associated out breaks, practices and conditions at sprouting facility and handling by consumers may also impact on the safety of the sprouts. Massive out breaks of Escherichia coli O157:H7 in Japan (Michino et al., 1999), O104:H4 in Germany (Buchholz et al., 2011) and France (European Food Safety Authority, 2011) all were associated with sprouts. Majority of these outbreaks were linked to alfalfa, mung bean, clover, radish, mustard, cress and fenugreek sprouts (Taormina et al., 1999; Bang et al., 2011; Buchholz et al., 2011).

However, literature is deficient with studies on chickpea sprouts which are commonly consumed in countries like India. Moreover, most of the studies on sprout microbiology are dealing with detection and sanitation. Response of the plant host (the sprouts) to human pathogenic bacteria remains largely unknown. Insights into the molecular level interactions of food-borne bacteria and the seed sprouts are very much needed to redesign our outbreak control strategies for better containment. As an initial step towards the aforesaid approach, we studied the chickpea sprout – E. coli interactome and herewith reporting the results of analysis of host colonizing gene expression in E. coli.

Materials and methods

Bacterial cultures: Clinical isolate of E. coli from children diarrheal sample (kind gift from Dr. Rathinasamy Subashkumar, Kongunadu Arts and Science College, Coimbatore, India) and E. coli K 12 substr. MG1655 (MTCC 1586) obtained from Microbial Type Culture Collection and Gene Bank Facility, Institute of Microbial Technology, Chandigarh, India were used in the study.

Sprouting of chickpea seeds: Chickpea seeds obtained from Tamil Nadu Agricultural University, Coimbatore, India, were surface sterilized according to the procedure of Bang et al. (2011) with modification. Seeds were treated with CIO2 solution (500 µg/ml) for 5 min, dried at 45°C for 24 h and dry heated at 70°C for 24 h. The seeds were aseptically placed in sterile Petri dishes with two layers of sterile filter papers (Whatman No. 1) wetted with sterile water. The plates were left undisturbed at room temperature in darkness for 3 days.

Induced colonization of sprouts by E. coli: Co-incubation of bacterial cultures with chickpea sprouts was done according to the procedure of Barak et al. (2005). To overnight 3 ml cultures of E. coli grown in nutrient broth at 37°C shaker incubator, about 5 sprouts were added per tube and incubation was continued for 4 h. Cultures without addition of sprouts were maintained as control. After 4 h, the sprouts were removed and the cultures were transferred aseptically to fresh sterile test tubes to which another set of fresh pea sprouts were added. The co-incubation was continued for another 4 h in shaker at 37°C. After this step, 10 µl of the cultures were transferred aseptically to 3 ml sterile nutrient broth in test tubes and new sets of sprouts were added. This was incubated overnight at 37°C with shaking. The procedure was repeated for 5 continuous days (each day with two 4 h incubation and an overnight incubation with sprouts). At the end of 5th day, the cultures were centrifuged at 8000 rpm for 10 min at 4°C. The bacterial pellet was used for RNA extraction.

RNA extraction and RT-PCR: Total RNA was isolated from bacterial cell pellet using RaFlex Kit (Genei, Bangalore, India) as per kit instructions. Primers to amplify intimin gene of E. coli (Gen Bank accession AF319597) were designed using Primer 3 software and validated using primer-BLAST tool of NCBI. Primers were synthesized at Bioserve Biotechnologies India Private Limited, Hyderabad, India. The forward and reverse primers are 5’ATGGCAGTATTGACGGATAC3’ and 5’GAGACATCACATAATCCGCC3’. First strand cDNA synthesis was carried out with 200 ng RNA, AMV reverse transcriptase and reverse primer using cDNA Synthesis Kit (Genei, Bangalore, India) as per the kit instructions. The reaction mixture was incubated at 42°C for one hour and terminated at 70°C for 10 min followed by chilling on ice. PCR was carried out using 5 µl of cDNA (synthesized from 200 ng RNA), 2 U Taq polymerase, 200 µM each dNTP and 1.5 mM MgCl2. Primers were used at 0.2 µM final concentration. Amplification was done with initial denaturation at 95°C for 2 min followed by 30 cycles of 95°C for 1 min, 49°C for 1 min and 72°C for 1 min. This was followed by final extension step of 72°C for 7 min. The PCR products were analyzed in 1% agarose gel stained with ethidium bromide.

Results and Discussion

Enteropathogenic E. coli (EPEC) is a diarrheal pathogen of young children in developing countries (Scaletsky et al., 2002). They are known to produce attaching and effacing (AE) lesions. In the lesions, the bacteria attach tightly to the host cell membrane (Contreras et al., 2010). The genes for the AE lesion are encoded in a 35.6 kb chromosomal pathogenicity island which consists of locus of enterocyte effacement (LEE) along with the genes involved in TTSS. The TTSS is involved in delivering bacterial proteins to the host cell whereby they interfere with the host cell processes. They have been found both in animal and plant pathogenic bacteria which indicate that they are capable of working across the eukaryotic systems (Galan and Collmer, 1999). The LEE region encodes for various proteins related to TTSS in which intimin and other proteins are secreted (Jores et al., 2004). The LEE and TTSS genes are expected to work in a coordinated fashion for attachment of bacteria to host cells. The intimate attachment is mediated by the outer membrane protein called intimin (Jerse et al., 1990) coded by eae gene (named after E. coli attachment and effacement factor).

1 2 3 4 5

Fig. 1. Expression analysis of E. coli eae gene co-incubated with chickpea sprouts

Lanes 1 – 1 kb marker, 2 – K12 strain without sprouts, 3 – K12 strain with sprouts; 4 – clinical isolate without sprouts, 5 – clinical isolate with sprouts

In the present study, we observed the expression of this eae gene in pathogenic strain of E. coli in the presence of sprouts. The results of semi-quantitative RT-PCR analysis are shown in Fig. 1. The primers designed were targeted to amplify a 1.1 kb fragment of the 2.6 kb gene. The expression of this gene was not found in K 12 strain in both cases because the strain lacks the pathogenicity island carrying this gene. Presence of sprouts and induced colonization has increased the expression of this gene in clinical isolate. Based on the observation, we propose the eukaryotic host colonization strategy by E. coli (whether animal or plant) overlaps at least with expression of intimin gene.