Levels Of Hepatitis B Virus Replicative Intermediate

Published Date: 02 Nov 2017

ABSTRACT

The monitoring of cccDNA levels can provide a direct indication of HBV activity in the liver of HBV infected patients. The aim of this study was to quantify the cccDNA levels in sera and intrahepatic levels of HBV DNA and cccDNA in liver biopsies of treatment naïve patients with chronic hepatitis B. Eighty one chronic HBV treatment naïve patients were enrolled from January 2009 to June 2011. The levels of intrahepatic HBV DNA and cccDNA were quantified using real time PCR method. The mean age of recruited patients was 34±11.5 years. A total of 54 patients (66.7%) were HBeAg negative. Liver biopsy was done in 23 patients (21 HBeAg negative and 2 HBeAg positive). The levels of total intrahepatic HBV DNA ranged from 0.09-1508.92 copies/cell. The median intrahepatic HBV cccDNA were 0.31 copies/cell (range 0.14-0.49 copies/cell) and 0.20 copies/cell (range 0.01-1.63 copies/cell) in HBeAg positive and HBeAg negative cases, respectively. The rate of serum HBV cccDNA detection was 85.2% and 48.1% in HBeAg positive and negative patients, respectively. The median level of serum HBV cccDNA was 46000 copies/mL in HBeAg positive cases, while it was 26350 copies/mL in HBeAg negative disease. The levels of intrahepatic HBV total DNA had a positive correlation with intrahepatic HBV cccDNA (r=0.533, p=0.009). A positive correlation was observed between serum cccDNA levels and serum HBV DNA levels (r=0.871, p<0.001). It was concluded that serum HBV DNA and serum cccDNA levels were significantly higher in HBeAg positive patients than HBeAg negative patients.

INTRODUCTION

Chronic hepatitis B infection is the most prevalent form of chronic viral hepatitis and constitutes a global public health problem, despite the widespread availability of an effective vaccine. It is a leading cause of morbidity and mortality and more than 400 million people in the world are chronically infected with hepatitis B virus (HBV) [van Zonneveld M et al. Hepatology 2004; 39: 804–810]. HBV is responsible for approximately 50% to 80% hepatocellular carcinoma (HCC) patients worldwide [Nguyen et al. J Viral Hepat. 2009;16:453-63]. HBV life cycle involves the formation of intracellular replicative intermediate, covalently closed circular DNA (cccDNA) through repairing of positive strand of the relaxed circular DNA (rcDNA) within the nuclei of hepatocytes. The cccDNA is a stable episome and acts as a template for viral and pregenomic messenger RNA. Since the HBV RNA-dependent DNA polymerase lacks a proofreading function, HBV has a high mutation rate [Fares and Holmes, 2002] and creates drug resistant strains which contribute to the viral cccDNA pool. [Yang SS, et al. World J Gastroenterol 2002; 8: 868-871].

The cccDNA being, the resource of new HBV progeny, is believed to be the main reason for HBV reactivation after cessation of antiviral therapy [Lewin SR et al. Hepatology 2001; 34: 1012-1020]. Therefore, monitoring of cccDNA levels can provide a direct indication of HBV activity in the liver of HBV infected patients [Yokosuka O et al. Hepatology 1985; 5: 728-734]. The majority of studies on estimation of cccDNA levels have been performed with liver tissue samples either from duck or woodchucks [Addison WR, et al. J Virol 2002; 76: 6356–6363; Lu M et al. J Virol 2001;75:3811–3818; Zhu Y et al. J Virol 2001;75:311–322]. As quatitation of cccDNA levels require liver biopsies, so there are only small sample sized reports that have evaluated the role of antiviral therapy in the reduction of cccDNA levels [Werle-Lapostolle B et al. Gastroenterology 2004;126:1750-1758; Wursthorn K et al. Hepatology 2006;44:675-684; Thompson AJ et al. Hepatology 2010;51:1933-1944]. Few reports have studied the role of circulating cccDNA in plasma [Takkenberg et al. J Med Virol 2009;81:988-995; Takkenberg et al. Eurpean Journal of Gastroenterology and Hepatology 2010;22:952-60]. There are some studies that have demonstrated the quatitation of cccDNA levels in sera of chronic HBV patients [Wong DK et al. Hepatology 2004; 40:727–737; Laras A et al. Hepatology. 2006 ;44:694-702; Zhong YW et al. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi 2008; 22 :225-7. Yuen MF et al. Am J Gastroenterol. 2005;100:1099-1103]. A study by Chen et al [World J Gastroenterol 2004;10(1):82-85] has concluded the occurrence of cccDNA in the sera as an early signal of liver damage. Studies have shown the rate of detection of cccDNA in serum of HBV patients from 60-75%. [Chen et al. 2010; Laras et al. 2006]. However, the data on cccDNA levels in sera of chronic HBV patients is scanty.

In this report, we aimed to quantify the cccDNA levels in a large number of serum samples from patients with chronic hepatitis B. We also investigated intrahepatic levels of HBV DNA and cccDNA in available liver biopsies.

PATIENTS AND METHODS

Patients

The study was approved by the Institutional Ethics Committee of PGIMER, Chandigarh, and an informed written consent was obtained from all subjects. Eighty one chronic hepatitis B treatment-naïve patients characterized by the presence of HBsAg in serum for a period of 6 months or more, who visited the liver clinic at the Department of Hepatology, Post Graduate Institute of Medical Education and Research (PGIMER), Chandigarh, India from January 2009 and June 2011, were enrolled in the present study. All subjects were positive for HBV DNA by PCR and negative for human immunodeficiency virus (HIV), and antibodies for hepatitis C virus (anti-HCV). Blood samples were obtained from all recruited subjects, and 23 synchronous liver biopsies were collected out of enrolled patients. Three liver biopsies were also collected from patients with disease other than HBV infection (two males and one female, aged 24-48 years) and used as negative controls. All patients included in the study were evaluated for serum bilirubin, ALT, AST, serum total protein, albumin, globulin, HBeAg, antibodies to the HBV e antigen (anti-HBe), and anti-HCV. Liver biopsy samples were examined for stage of fibrosis, and grade of necroinflammatory activity. Detection of HBsAg, HBeAg, antibodies to the HBV e antigen (anti-HBe), and anti-HCV were performed via enzyme-linked immunosorbent assay (ELISA) using commercially available kits. HBV DNA levels were quantified by the Cobas amplicor HBV monitor test (Roche Diagnostics GmbH, Mannheim, Germany).

HBV Genotyping

HBV DNA was extracted from the serum samples using the QiaAmp DNA mini kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer’s instructions. The quantity and quality of DNA were measured using an ultraviolet (UV) spectrophotometer (Model-DU 640, Beckman Coulter, Brea, USA). In order to determine the HBV genotype of each sample, multiplex PCR was performed, using genotype-specific primers that have been described previously [Singla et al., 2013]. Multiplex PCR was performed using the Takara PCR Thermal Cycler Dice™ (Takara Bio Inc., Shiga, Japan) and was carried out in a total volume of 50 L. Annealing temperature for multiplex PCR was 61°C. The amplified fragments were electrophoresed on a 2.5% agarose gel, stained with ethidium bromide, and evaluated under UV light. The sizes of the PCR products were estimated by comparison to the migration pattern of a standard 50bp DNA ladder (GeneDirex, Taipei, Taiwan).

Standard Preparation for cccDNA Quantification

To prepare the standards for cccDNA level determination, a fragment of 420 base pairs was amplified using primers described in table I. The Integrity of amplicon was verified through size determination using agarose gel electrophoresis and bidirectional sequencing. The concentration of the amplified product was measured with a spectrophotometer (GeneQuant, Amersham, Germany) after purification using a Qiagen purification kit (Qiagen GmbH, Hilden, Germany) according to manufacturer’s instructions. The number of copies per unit volume (ml) was calculated using the formula described elsewhere [Yin JL. Immunol Cell Biol. 2001;79:213-21]. Serial dilutions of this stock solution served as quantification standards to plot the standard curve.

No. of copies/ml = 6.023 x 1023 x C x OD260

Mwt

Where

6.023 x 1023 = Avogadro’s no. C= 5 x 10-5 g/mL for DNA

Mwt = bp x 6.58 x 102 g OD260 = Absorbance at 260 nm

Quantification of cccDNA and Intrahepatic Total HBV DNA

DNA was isolated from serum and liver tissue samples by the QIAamp DNA Mini Kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer’s instructions. Real Time PCR was performed on the LightCycler480 machine (Roche Diagnostics GmbH, Mannheim, Germany) using the SYBR Green detection method to determine the quantity of cccDNA and intrahepatic total HBV DNA. The 20L reaction mixture contained 5L of the plasmid-safe ATP-dependent DNase treated DNA sample, 10L of 2x Fast Start SYBER Green master mix (Roche Diagnostics, Mannheim, Germany), 10picomoles of each primers and double distilled water . Forward and reverse primers were 5’-GTGCCTTCTCATCTGCCGG-3’ and 5’- GGAAAGAAGTCAGAAGGCAA - 3’ for cccDNA amplification, respectively, and 5’-GTATGTTGCCCGTTTGTCC- 3’ and 5’-CCCTACGAACCACTGAAC- 3’ for total intrahepatic HBV DNA quantification, respectively. Real Time PCR was programmed to incubate the samples for 10 min at 95°C, followed by 45 cycles consisting of 94°C for 25 sec, 52°C for 26 sec and 72°C for 15 sec to quantify cccDNA levels. Annealing temperature for quantification of intrahepatic total HBV DNA was 55°C for 20 seconds.

To determine the cell number in the liver biopsies, β-globin was taken as a housekeeping gene. LightCycler Control Kit (Roche Diagnostics GmbH, Mannheim, Germany) containing β-globin primer and standards of human genomic DNA of known concentration, was used according to manufacturer’s instructions to measure the amount of genomic DNA and to calculate the number of cells in the liver tissue samples.

Statistical Analysis

All statistical analyses were performed using SPSS software version 16. The categorical variables were expressed as number and percentage. Normally distributed continuous variables were summarized as mean±SD, otherwise, as median along with range. The chi-square test was used for comparison of nominal categorical variables. Intergroup comparison of continuous skewed data was evaluated by Mann-Whitney U test. For determination of correlation between different variables Spearman’s correlation coefficient was used, whenever appropriate.

A p value <0.05 was considered statistically significant.

RESULTS

Patient Clinical Features

The clinical data of 81patients with chronic hepatitis B is shown in Table I. Of these, 63 (77.8%) were males and 18 (22.2%) were females. A total of 54 patients (66.7%) were HBeAg negative. The mean age was lesser in HBeAg positive patients (28±8.1 years) than in patients with HBeAg negative disease (37.0±11.9 years). The median serum HBV DNA level was 7.8 log10 copies/mL (range 4.4-10.0 log10 copies/mL) in HBeAg positive patients and 5.9 log10 copies/mL (range 3.8-9.8 log10 copies/mL) in HBeAg negative patients. The median values of ALT, AST, Knodell HAI grade, and Ishak fibrosis stage were comparable between HBeAg positive and HBeAg negative groups.

A positive correlation was observed between HBeAg positivity and serum HBV DNA levels (r = 0.416, p=0.000), and a negative correlation was observed between age and HBeAg positivity (r = -0.354, p = 0.001). The ALT levels were found to correlate positively with fibrosis stage (r=0.461, p=0.031), and HBV DNA levels (r =0.310, p=0.005) (Fig. 1).

HBV Genotyping

Multiplex PCR performed with genotype specific primers revealed variations in the length of the amplicon according to HBV genotype. HBV genotype D was the most common genotype and observed in 69 patients (85.2%). Genotype C and A were found in 8 (9.9%) and 4 patients (4.9%), respectively. HBV genotype did not show any correlation with ALT levels, fibrosis stage, serum HBV DNA levels, gender, and HAI grade.

Quantification of Intrahepatic HBV cccDNA, and Total Intrahepatic HBV DNA

The liver tissues of 3 patients with disease other than HBV infection were negative for HBV cccDNA, and total intrahepatic HBV DNA. The levels of intrahepatic HBV cccDNA and total HBV DNA were determined in 23 liver tissue samples collected from chronically infected HBV patients (Table II). The median of total intrahepatic HBV DNA was 8.19 copies/cell (range 129.59-1508.92 copies/cell) in HBeAg positive group, while it was 10.32 copies/cell (range 0.09-1164.50 copies/cell) in HBeAg negative group. These levels were significantly different between HBeAg positive and HBeAg negative patients. The median intrahepatic HBV cccDNA were 0.31 copies/cell (range 0.14-0.49 copies/cell) and 0.20 copies/cell (range 0.01-1.63 copies/cell) in HBeAg positive and HBeAg negative cases, respectively. A positive correlation was observed between levels of intrahepatic HBV total DNA and intrahepatic HBV cccDNA (r=0.533, p=0.009) by combining the results of all patients regardless of HBeAg status. The ratio of cccDNA to total DNA was found inversely correlated to the intrahepatic total DNA levels (r= -0.756, p=0.000) (Table III) (Fig. 2A).

Quantification of Serum HBV cccDNA

Serum samples from all recruited patients were evaluated for the presence of HBV cccDNA by real time PCR method. In serum samples, HBV cccDNA was measurable in 49 patients (60.5%). Out of these, 23 patients (28.4%) were HBeAg positive and 26 patients (32.1%) were in HBeAg negative. The rate of serum HBV cccDNA detection was observed 85.2% (23/27) and 48.1% (26/54) in HBeAg positive and negative patients, respectively. The median level of serum HBV cccDNA was 46000 copies/mL (range 1780-747000 copies/mL) in HBeAg positive cases, while it was 26350 copies/mL (range 530-73000 copies/mL) in HBeAg negative disease. Therefore, the levels of serum HBV cccDNA were significantly different between HBeAg positive and HBeAg negative patients (Table II). A positive correlation was detected between serum HBV cccDNA and serum HBV DNA levels both in HBeAg positive and negative patients (Table III) (Fig. 2B & 2C). The details of observed significant correlation among different parameters are given in Table III.

DISCUSSION

The cccDNA pool in the nuclei of hepatocyte is responsible for the persistence of HBV infection [Tuttleman JS et al. Cell 1986;47:451-460; Newbold JE et al. J Virol 1995;69:3350-3357]. The mechanism of cccDNA elimination remains controversial. It is considered that its elimination is a result of hepatocytes turnover. Major obstacles to determine the cccDNA levels include (i) requirement of liver biopsies; (ii) lack of "gold standard" method for quantification of cccDNA levels. In this study, we have developed and employed SYBR Green detection method for the quantification of HBV cccDNA and intrahepatic total HBV DNA using real time PCR in liver biopsy and serum samples of chronic HBV patients. The primers used in this study for determination of cccDNA levels in serum and tissue samples, amplified the conserved region flanking the direct repeats DR1 and DR2, therefore, it avoided the nonspecific signal caused by amplification of relaxed circular DNA of hepatitis B virus

As described earlier, this present study found a positive correlation between HBeAg positivity and serum HBV DNA levels (r = 0.416, p < 0.001) and a negative correlation between age and HBeAg positivity (r = -0.354, p = 0.001) in chronic HBV patients [Shao et al., 2007]. There was a correlation between the fibrosis stage and ALT levels in enrolled patients (r= 0.461, p=0.031). Previous study has also observed the positive correlation of ALT with fibrosis stage and HAI grade (r = 0.744, p= < 0.01) in HBeAg positive patients [Shao et al., 2007]. The present study found a positive correlation of ALT levels with serum HBV DNA levels (r =0.310, p=0.005) in HBeAg negative patients. A study by Thompson et al has shown the association of ALT levels with serum HBV DNA concentration. [Thompson AJV et al. Hepatology 2010;51:1933-1944]. A strong correlation has also been revealed between the serum HBV-DNA and ALT levels in Japanese HBeAg negative subjects [Sakugawa etal., 2001].

The intrahepatic HBV cccDNA and total HBV DNA were determined in 23 liver tissue samples (21 HBeAg negative and 2 HBeAg postive) of chronically infected HBV patients. The median levels of total intrahepatic HBV DNA observed 8.19 copies/cell and 10.32 copies/cell in HBeAg positive and HBeAg negative patients, respectively. Earlier studies have shown higher median level of intrahepatic HBV DNA in HBeAg positive patients in comparison to HBeAg negative chronic HBV patients [Werle-Lapostolle B et al. Gastroenterology 2004; 126:1750–1758; Laras A et al. Hepatology. 2006; 44:694-702]. This difference in results may be because of the presence of less liver biopsies (n=2) in HBeAg positive group. The observed ranges of total intrahepatic HBV DNA were 129.59-1508.92 copies/cell and 0.09-1164.50 copies/cell in HBeAg positive and negative patients, respectively. These observed ranges of total intrahepatic HBV DNA were in concordance with previous studies [Werle, Laras]. In the present study, the median intrahepatic HBV cccDNA was higher in HBeAg positive cases in comparison to HBeAg negative cases (0.31 copies/cell vs 0.20 copies/cell), as reported earlier [Thompson AJV et al]. Thompson et al has found median intrahepatic HBV cccDNA levels of 3.65 copies/cell and 0.2 copies/cell in HBeAg positive and negative patients, respectively. The present study found a positive correlation between intrahepatic HBV total DNA and intrahepatic HBV cccDNA (r=0.533, p=0.009) and an inverse correlation between the ratio of intrahepatic cccDNA to intrahepatic total DNA and intrahepatic total DNA levels (r= -0.756, p=0.000). A recently published study by Wang et al. has observed the similar correlation among these parameters (r=0.432 for intrahepatic HBV total DNA and intrahepatic HBV cccDNA; r= -0.812 for the ratio of intrahepatic cccDNA to intrahepatic total DNA and intrahepatic total DNA levels) in treatment naïve chronic hepatitis B patients [Wang et al. Journal of Medical Virology 2013; 85:219-227]. These results suggest that the presence of the lower level of intrahepatic HBV DNA would increase the cccDNA/total DNA ratio, entirely in the form of nonreplicative HBV cccDNA. Similar results have been obtained in previous study involving patients with chronic hepatitis B [Wong et al. Hepatology 2004; 40:727–737].

The source of cccDNA in serum of HBV infected patients is unclear. It is believed that a majority of serum cccDNA originates from the lysis of infected hepatocytes, thereby releasing cccDNA present in the nuclei of hepatocytes into the blood circulation. Peripheral blood mononuclear cells makes some contribution to the pool of cccDNA in serum of HBV infected patients [Cabrerizo M et al. Hepatology. 2000;32:116-23]. There are some studies which have shown the loss of intahepatic cccDNA during the process of cell division, this can also be responsible for presence of cccDNA in serum [Moraleda G et al. J Virol. 1997;71:9392-9; Zhu Y et al. J Virol. 2001;75:311-22]

This is the first report from India and largest from abroad, which evaluated the level of HBV cccDNA in serum samples of 81 patients with chronic HBV infection. HBV cccDNA was detectable in serum samples of 60.5% patients. Previous studies have detected serum cccDNA in 66-75% of chronic HBV cases.[Laras; Wong]. Approximately 85% HBeAg positive and 48% HBeAg negative patients showed the presence of HBV cccDNA in sera of patients. The levels of serum HBV cccDNA ranged from 1780-747000 copies/ml in HBeAg positive cases, which was higher than observed in HBeAg negative disease. These results were consistent with previous studies [Laras; Wong]. As mentioned earlier, there was a positive correlation between serum HBV cccDNA and serum HBV DNA levels both in HBeAg positive and negative patients [Laras; Wong]. However, the current study detected lower serum cccDNA levels than those reported by Wong et al [Wong]. This difference in results may reflect differences in methodology or the characteristics of patients and viral strains in the two studies.

Previous studies have shown the decrease in serum cccDNA during treatment with oral antiviral [Yuen MF et al. Am J Gastroenterol. 2005; 100:1099–1103]. They have concluded that studying the levels of both total HBV DNA and cccDNA in the serum could allow some insight into the decline of both the replicative and non-replicative forms of virus.

In conclusion, the present study shows the estimation of the levels of HBV cccDNA both in the liver biopsies and serum samples of chronic HBV patients. HBeAg positive patients have higher serum HBV DNA and serum cccDNA levels than HBeAg negative patients. Intrahepatic total HBV DNA and cccDNA are detected lower in HBeAg positive cases, because of the presence of less number of liver biopsies in this group. The combined measurement of serum HBV DNA and serum cccDNA during the treatment can provide valuable information on the natural history of disease and duration of therapy needed.