Distinct Shared And Opposite Roles

Published Date: 02 Nov 2017

Qiang Guo1, Yirong Kong1, Dayong Dong, LiangLiang Li, Ju Liu, Jun Zhang, Ling Fu,

Junjie Xu2, Wei Chen2

State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Biotechnology, Beijing, China, 100071

1 Qiang Guo and Yirong Kong contributed equally to the work.

2 Address correspondence and reprint requests to Dr. Junjie Xu and Dr. Wei Chen. State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Biotechnology, 20 Dongda Street, Fengtai District, Beijing, China, 100071. Email Address: [email protected] (JX); [email protected] (WC)

Abbreviations used in this paper: LT, lethal toxin; ET, edema toxin; PA, protective antigen; BMMC, bone marrow-derived primary mast cell; SDH, succinate dehydrogenase;

Running Title: Mast Cell Functions Modulation by Anthrax Toxins

Abstract:

Anthrax lethal toxin and edema toxin are the major virulence factors of B.anthracis. They play essential roles in establishing infection and are responsible for the lethality and symptoms associated with anthrax disease. Mast cells act as sentinel immune cells to detect invaded bacteria pathogens directly and send signals to modulate both innate and adaptive immune response. Almost nothing is known regarding the modulation of mast cell function by anthrax toxins. Here, we investigated the effect of LT and ET on functions of C57BL/6 mouse bone marrow-derived primary mast cells. We show that BMMCs are targets for anthrax toxins and resistant to toxins killing. Furthermore, both LT and ET act as inhibitors of mast cell degranulation and most cytokines/chemokines production mediated by TLR. More importantly, we provide the first demonstration that LT and ET oppositely modulate CCL-5 production and SDH activity. LT enhances CCL-5 production, while ET inhibits CCL-5 production; LT inhibits SDH activity, while ET enhances SDH activity. Taken together, these results suggest the distinct roles of these toxins on BMMC viability, shared roles on BMMC cytokines/chemokines production and degranulation, and opposite roles on CCL-5 production and SDH activity. These findings reveal a new level complexity for immune modulation function of anthrax toxins.

Preface

Bacillus anthracis, a spore-forming bacterium, is the causative agent of anthrax. It secretes two toxins, lethal toxin (LT) and edema toxin (ET) which are formed by protective antigen (PA) in combination with lethal factor (LF) or edema factor (EF) respectively. Once binding with its receptors on cell surface, PA forms heptameric pores which traffic LF and EF to the cytosol. LF is a Zn2+-dependent endopeptidase that specifically cleaves and inactives most members of the MAPKK family of intracellular signaling proteins, and EF is a calmodulin-activated adenylate cyclase that increases cAMP concentration of eukaryotic cells[1]. Anthrax toxin is the major virulence factor of B.anthracis. Its necessary role in establishing infection has been strongly supported by evidence that toxin deficient mutants of B.anthracis are significantly attenuated in animal models and anthrax toxin receptor knock-out mice are highly resistant to B.anthracis infection[2,3,4,5]. So far, several kinds of immune cell which include macrophages, neutrophils, dendritic cells, T cells, B cells and endothelial cells have been shown as targets of anthrax toxins [6]. Although the exact mechanism of anthrax toxin modulating host immune system and the pathology of anthrax remains to be fully understood, the knowledge about how anthrax toxin modulates these cells function improves our understanding of the interaction between host and B.anthracis greatly.

Mast cell has long been recognized as effector cells in allergic disease, such as asthma. However, in recent years, mast cell’s protective role in immune defense against bacteria pathogen was gradually established by studies with mast cell deficient mouse [7,8,9]. Compared with wild type mice, mast cell-deficient mice were found more sensitive to infection with a series of clinical significance bacteria pathogen. When their mast cell function was reconstituted with cultured bone marrow-derived primary mast cells, their ability to combat infection was recovered. Mast cell express Fc receptors and several complement receptors which confer mast cell the ability to respond to opsonised organisms [10,11]. Like macrophages and neutrophils, mast cell also expresses pattern recognition receptors (PRRs), which include TLR, NLR and RIG-1, etc [12,13,14]. Mast cells were shown to kill bacteria directly via phagocytosis and reactive oxygen species production, releasing antimicrobial peptides, or forming extracellular traps that encompass and kill bacteria pathogens in vitro[15,16,17]. More importantly, mast cells are also strategically positioned at the interface between host and environment, such as skin, lung and gut to sense the invaded bacteria pathogen and initiate innate response at the site of infection by releasing bioactivity substances, such as cytokines and chemokines which can recruit neturophils to the infection site and enhance macrophage’s ability to kill intracellular bacteria [18,19]. Mast cells were also shown to regulate adaptive immunity by selectively migration to lymphnodes and releasing TNF-α and CCL-5 to recruit dentritic cells and T cells [8]. Compound 48/80, a specify activator of mast cells, is a potent adjuvant for anthrax protective antigen [20]. Modulation of mast cell function may give the pathogens a good way to inhibit host innate immunity and adaptive immunity.

In this study, we focused on BMMCs treated with anthrax lethal toxin or edema toxin to investigate the effect of LT and ET on mast cell function. We showed the novel findings regarding the distinct roles of these toxins on BMMC viability, shared roles on BMMC cytokines/chemokines production and degranulation, and opposite roles on CCL-5 production and SDH activity. These results suggest complex roles of LT and ET on modulating mast cell function.

Materials and Methods

Reagents

All tissue culture reagents, TRIZOL and SuperScript First Strand Synthesis System were purchased from Invitrogen. Rabbit anti-MEK1, PD98059 and SB203580 were obtained from Millipore. Donkey anti-mIL-1β and Mouse TNF-α DuoSet ELISA Development system were from R&D, Rabbit anti-mosue actin, HRP-labeled goat anti-rabbit IgG and HRP-labeled donkey anti-goat IgG were from Santa Cluz. rSCF and rIL-3 were purchased from PROSPEC. SYBR Premix Ex Taq was from TaKaRa. CellTiter 96® AQueous One Solution Cell Proliferation Assay (MTS) was obtained from Promega. rPA, rLF and rEF were generated as described previously[21,22,23]. All primers were from PrimerBank (http://pga.mgh.harvard.edu/primerbank/citation.html). All other reagents were purchased from Sigma-Aldrich, unless specified otherwise.

Cell generation and culture

BMMCs were prepared as described in Reference [24]. In brief, the femurs of mice were removed and flushed with RPIM1640 medium. The bone marrow cells were collected and cultured in the same medium supplemented with 10% FBS, glutamine (2 mM), penicillin (100 IU/mL), Streptomycin (100 µg/mL), 5 ng/ml recombinant stem cell factor and 5 ng/ml IL-3. Change flask and medium every week. BMMCs were harvested at 4 weeks for all experiments. The purity of the mast cells were determined with flow cytometry by using FITC-conjugated anti-FcεR I (e-Bioscience) and PE- conjugated anti-c-Kit.

P815 is a mast cell line which was obtained from Cell Resource Center of Chinese Academy of Medical Science and cultured in MEM medium (Invitrogen) supplemented with 10% FBS (Hyclone), 2 mM L-glutamine (Invitrogen), 100 U/ml penicillin G, and 100 μg/ml streptomycin sulfate and maintained at 5% CO2 in a humidified atmosphere.

ATR expression and MEK1 cleavage

The assay of anthrax toxin receptor expression in BMMCs was performed with reverse transcription. Total RNA was extracted from BMMCs and P815 cells using TRIZOL and reversely transcripted to cDNA with SuperScript First Strand Synthesis System. The following TEM8, CMG2 and β-actin primers were used in standard PCR: TEM8 Forward, 5’-AGCAGTTGGCTCATAGATTCATC-3’ and TEM8 Reverse, 5’- CCTTGTCGGATCTGTTCCCTG-3’ were used for TEM8. CMG2 Forward, 5’- CTCTTGCAAAAAAGCCTTCG -3’ and CMG2 Reverse, 5’- TTCTTTGCCTCGTTCTCTGC -3’ were used for CMG2. β-actin Forward, 5’-CGAGGCCCAGAGCAAGAGAG-3’ and β-actin Reverse, 5’- CTCGTAGATGGGCACAGTGTG -3’ were used for β-actin. The amplification were performed as follows: initial denaturation at 94℃ for 3 min, followed by 40 cycles of amplification: 94℃ for 20 sec, 60℃ for 20 sec, and 72℃ for 20 sec. Following PCR, amplification product was analyzed on a 2% agarose Gel.

MEK1 cleavage was determined by immunoblotting, using rabbit polyclonal anti-MEK1. BMMCs were exposed to toxin proteins or not. Cells were washed once with cold PBS, and then lysed by adding 1× SDS-PAGE loading buffer at 2h after toxin exposure. The cell lysate was boiled at 95℃ for 30min. Total protein was separated by a 12% SDS-PAGE and then Western blotted with rabbit polyclonal anti-MEK1 and rabbit anti-β-actin.

BMMC viability assay

The viability of BMMCs treated with toxin protein was measured by trypan blue. Cells exposed to toxin proteins for various times were stained with 0.4% trypan blue solution. Cell numbers were counted under light microscopy.

BMMC cytokine expression assay

TNF-α was assayed by ELISA. 100 μl BMMCs were plated in 96-well plates at 106/ml and exposed to toxin proteins. 10 μg/ml LPS were added to wells at 2h after toxin exposure, and were incubated in a cell incubator for 18h. TNF-α in supernatant was measured with mouse TNF-α ELISA Kit according to the manufactory’s instruction.

IL-1β was measured using immunoblot. 200 μl BMMCs were plated in 96-well plates at 106/ml and exposed to toxin proteins. 10 μg/ml LPS were added to wells at 2h after toxin exposure, and were incubated in a cell incubator for 6h. Cells were collected and washed once with cold PBS, and then lysed by adding 1× SDS-PAGE loading buffer. The cell lysate was boiled at 95℃ for 30min. Total protein was separated by a 12% SDS-PAGE and then Western blotted with donkey anti-mIL-1β and rabbit anti-β-actin.

CCL-2, CCL-5, IL-6 and IL-13 were measured by quantitative PCR. 3ml BMMCs were plated in 6-well plate at 106/ml and exposed to LT (100ng/ml PA plus 50ng/ml LF) or ET (100ng/ml PA plus 50ng/ml EF). 10 μg/ml LPS were added to wells at 2h after toxin exposure, and were incubated in a cell incubator for 3h. Cells were collected and washed once with cold PBS. Total RNA was extracted using TRIZOL and reversely transcripted to cDNA with SuperScript First Strand Synthesis System from Invitrogen. quantitative PCR was performed with SYBR Premix Ex Taq (TaKaRa) on a Roche LightCycler2.0 instrument. The following primers were used for real time PCR: CCL-2 Forward, 5’- TTAAAAACCTGGATCGGAACCAA -3’ and CCL-2 Reverse, 5’- GCATTAGCTTCAGATTTACGGGT -3’ were used for CCL-2. CCL-5 Forward, 5’- GCTGCTTTGCCTACCTCTCC -3’ and CCL-5 Reverse, 5’- TCGAGTGACAAACACGACTGC -3’ were used for CCL-5. IL-6 Forward, 5’-CTGCAAGAGACTTCCATCCAG-3’ and IL-6 Reverse, 5’-AGTGGTATAGACAGGTCTGTTGG-3’ were used for IL-6. IL-13 Forward, 5’- CCTGGCTCTTGCTTGCCTT -3’ and IL-13 Reverse, 5’- GGTCTTGTGTGATGTTGCTCA -3’ were used for IL-13. β-actin Forward, 5’- GGCTGTATTCCCCTCCATCG -3’ and β-actin Reverse, 5’- CCAGTTGGTAACAATGCCATGT -3’ were used for β-actin. The amplification were performed as follows: initial denaturation at 95℃ for 30 sec, followed by 40 cycles of amplification: 95℃ for 5 sec, 60℃ for 20 sec. Melting curve: conditions were; 95℃, 65℃ for 15 s, and 95℃ (slope 0.1℃/s). Analysis was performed according to ΔΔCt (delta delta Ct) method. Results are expressed as a ratio of cytokine/chemokine to β-actin.

BMMC degranulation and granule content assay

The effect of anthrax toxins on BMMCs degranulation induced by IgE was determined as described in the following. BMMCs (106/ml) that were sensitized with 1μg/ml Anti-DNP IgE overnight were seeded into 96-well plates in a total volume of 50 μl and exposed to different concentrations of toxin proteins. Cells were washed twice with HEPES buffer containing 1mg/ml BSA and corresponding toxin proteins at 2h after toxin exposure and exposed to DNP-BSA (10μg/ml) for 30min. For total β-hexosaminidase release, control cells were lysed in 50 μl of 0.1% Triton X-100. Aliquots (20 μl) of supernatants or cell lysates were applied to β-Hexosaminidase assay.

The effect of anthrax toxin on BMMCs granule content was determined as described in the following. 45 μl BMMCs were plated in 96-well plates at 106/ml and exposed to 5 μl toxin proteins. Cells were washed twice with HEPES buffer containing 1mg/ml BSA and toxin proteins at 4h or 8h after toxin exposure. Cells were lysed in 50 μl of 0.1% Triton X-100. Aliquots (20 μl) of supernatants or cell lysates were applied to β-Hexosaminidase assay.

Whether anthrax toxins can induce BMMCs degranualtion was determined as described in the following. BMMC cells (106/ml) were seeded into 96-well plates in a total volume of 50 μl of HEPES buffer containing 1 mg/ml BSA and exposed to different concentrations of toxin proteins for 2h. For total β-hexosaminidase release, control cells were lysed in 50 μl of 0.1% Triton X-100. Aliquots (20 μl) of supernatants or cell lysates were applied to β-Hexosaminidase assay.

β-hexosaminidase assay was performed as described in the following. In brief, 20 μl cell supernatants or cell lysates were incubated with 20 μl of 1 mM p-nitrophenyl-N-acetyl-b-D-glucosamine for 1.5 h at 37℃. The reaction was stopped by adding 250 ml of a 0.1 M Na2CO3/0.1 M NaHCO3 buffer and absorbance was measured at 405 nm.

SDH activity assay

BMMCs SDH activity was measured by analysis of its ability to reduce MTS to formazan in living cells with CellTiter 96® AQueous One Solution Cell Proliferation Assay (MTS) from Promega. In brief, 30,000 BMMCs /well were plated in 96-well plates and exposed to toxin proteins. 20 μl CellTiter 96® AQueous One Solution were added to wells at 2h after toxin exposure, and were incubated in a cell incubator for 3h. The plates were read at 490 nM.

Data analysis

Unless specified otherwise, the results are expressed as mean ± S.E.M for the values obtained from multiple experiments. Statistical significance was determined by unpaired two-tailed t test. *, p,0.05; **, p,0.01; ***, p,0.001.

Results

1. Murine mast cells are targets for anthrax toxin and resistant to anthrax toxin killing.

BMMCs we used in this study are murine primary mast cells derived from bone marrow cells cultured in the presence of rIL-3 and rSCF. It was widely used to study mast cell’s function in host innate immune defense [8]. We initially confirmed that BMMCs express anthrax toxin receptors. As shown in Fig 1A and 1B, the expression of CMG2, one of the two indentified anthrax toxin receptors, was detected in BMMCs with reverse transcription PCR, the other receptor, TEM8, was not. But interestingly, the expression pattern of these two receptors in a murine-derived mast cell line, P815, is on the contrary. The expression of TEM8 in P815 was detected, but not CMG2. Next, we investigated whether anthrax toxin can enter into BMMCs to cut its MEK substrate. As previously shown in other type of cells, after treatment with anthrax lethal toxin, the effective cleavage of MEK1 in N-terminal was observed in BMMCs (Fig 1b). These results showed that BMMCs are targets for anthrax toxin and CMG2 is the major receptor that mediates anthrax toxin’s entry into BMMCs.

To determine the effect of anthrax toxins on BMMCs survival, cells were exposed to toxins, and cell viability was determined at different time points after LT exposure using trypan blue staining. It is consistent with other C57BL/6-derived myeloid cell types that C57BL/6-derived BMMCs are resistant to LT killing. LT treatment had no obvious effect on BMMC survival during the first 3-day culture, and cell number drops only after 4-6 days of LT exposure (Fig 2A). As expected, ET exposure even for 6 days has no obvious effect on C57BL/6-derived BMMCs viability (Fig 2B). These findings demonstrate that cell killing may be not the way that anthrax toxins employed to inhibit mast cell’s immune function in the early phase of infection.

2. LT and ET differently modulate TLR-mediated BMMC cytokines/chemokines production

Mast cell expresses pattern recognition receptors (PRRs), including the Toll-like receptors (TLRs), Nod-like receptors and C-type lectins. Among them, the involvement of TLR in mast cell’s host defense function has been demonstrated by several reports [25,26]. PGN/LPS stimulation of BMMCs via TLR2/TLR4 leads to antimicrobial peptides and cytokine/chemokine release. The former can kill bacteria pathogen directly[27], and the latter may mediate the indirect effects of mast cell by coordinating host innate and adaptive responses, such as recruitment of other inflammatory cells including neutrophils, DC and enhancing macrophage’s killing[18,19,28]. To investigate the effect of LT and ET on BMMCs cytokine/chemokine production via TLR, we treated BMMCs with LT or ET for 2h, and then added LPS to stimulate the cytokine/chemokine production. As shown in Fig 2, we observed BMMCs express IL-1β, TNF-α, IL-6, IL-13, CCL-2 and CCL-5 when stimulated with LPS. Both LT and ET significantly inhibit the production of TNF-α, IL-6, IL-13 and CCL-2. But they differently modulate the production of IL-1β and CCL-5. IL-1β expression was strongly reduced when BMMCs were pre-treated with LT, however, ET has no effect on IL-1β expression. CCL-5 expression was significantly inhibited in the presence of ET, but in sharp contrast, it was strongly enhanced by LT. These data suggests that both LT and ET can inhibit most TLR-mediated cytokines/chemokines production and their cooperation may exert the most strongly inhibitory effect.

3. Both LT and ET inhibit BMMCs degranulation

The granular of mast cell contains a lot of bioactivity substances, such as histamine, etc. once activated, mast cell can release these pre-formed bioactivity substances in granular through a process called degranulation to modulate host innate and adaptive immunity [9]. To investigate the effect of LT and ET on BMMCs degranulation, anti-DNP IgE sensitized cells were treated with anthrax toxin before incubation with DNP-BSA. As shown in Fig 3a and 3b, both LT and ET inhibited FcεRI-mediated β- hexosaminidase release from BMMCs in a dose-dependent manner. At a concentration of 100ng/ml PA plus 50ng/ml LF or EF, β-hexo release was inhibited by more than 70%. To rule out the possibility that LT / ET exposure reduces the β- hexosaminidase content in the BMMC granular or LT/ET causes degranulation directly in BMMCs, we determined the effect of LT/ET exposure on β-hexo content in granular and measured β-hexo activity in supernatant after LT/ET exposure. As shown in Fig 3c and 3d, LT/ET exposure had no effect on β- hexosaminidase content in granular, even at a higher toxin concentration. And neither LT nor ET can cause BMMCs degranulation (Fig 3e and 3f). These results suggest that LT and ET have shared role on inhibiting mast cell degranulation.

4. Anthrax lethal toxin and edema toxin have controversial effects on mast cell SDH activity

SDH is a component of complex II. MTS is a closely related tetrazolium dye of MTT and used to measure cell viability. It was reported that mitochondria succinate dehydrogenase is responsible for the reduction of MTS into colored formazan product that is soluble in tissue culture medium [29]. As shown is Fig 4a and 4b, after LT exposure, the MTS signal declined to levels only half of those observed in BMMCs treated with PA or LF alone. By contrast, ET treatment had only marginal effect on MTS signal, about 7% increase than control. Since trypan blue staining had demonstrated that both LT and ET do not kill BMMCs quickly, the effect of LT and ET on MTS signal should be caused by their effect on SDH activity directly or indirectly. These data demonstrate that while LT inhibits SDH activity in BMMCs, ET enhances SDH activity, although not much. Previous reports have shown that LT proteolytically degrade MEK family members, resulting in the inhibition of ERK and p38 activation. To gain insight into the possible mechanism of LT inhibition on SDH activity, the effect of ERK and p38 inhibitors on MTS signal was examined. Fig 4c shows that it is p38 inhibitor, SB203580, significantly inhibited MTS signal, and ERK inhibitor, PD98059, has no effect on MTS signaling, but it can enhance the inhibition effect of SB203580.

Disscusion

Mast cells are sentinel immune cells that protect against infections mainly by modulating innate and adaptive immune response. Anthrax toxins are one of the two most important virulence factors of B.anthracis. They are critical for the establishment of infection and the pathogenesis of anthrax. Almost nothing is known regarding the modulation of mast cell function by anthrax toxins. In the present study, we report for the first time, to our knowledge, the effect of both anthrax lethal toxin and edema toxin on mast cell function. Our results showed that like other innate immune cells, BMMCs are targets for anthrax toxins and resistant to toxins killing. Furthermore, both LT and ET act as inhibitors of mast cell degranulation and cytokines/chemokines expression. More importantly, we provide the first demonstration of the opposite role of LT and ET in modulating CCL-5 production and SDH activity.

TLR-mediated cytokines/chemokines production is one of the critical ways by which immune cells modulate the immune responses to combat invaded bacteria pathogens. Previous reports with monocytes, T cells and DCs showed that both LT and ET suppress TLR-mediated cytokines/chemokines production [6]. Study with DCs has shown that LT inhibits IL-10 production, whereas ET inhibits IL-12p70 production, and both of them inhibit TNF-α secretion. A cooperational role of LT and ET was suggested [30]. Using BMMCs treated with LT or ET, we found that this is also the case in mast cell for most cytokines/chemokines production. But, unexpectedly, our data suggest this rule can not apply to CCL-5 production in mast cells. In our study, there was an opposite role of LT and ET in modulating mast cell CCL-5 expression. CCL-5, also known as RANTES, is a chemotactic for recruiting leukocytes into inflammatory sites [31]. This observation makes us to speculate that there may be a differential production of CCL-5 during the anthrax infection depending on the relative amount of each toxin component, timing and site of production. This speculation leads to many questions, including the role of this kind of inflammation enhancement function of LT in anthrax infection.

In this study, we showed that both LT and ET have the same inhibitory effect on mast cell degranulation. The reduction in degranulation is not due to toxin-induced less granular content, as total β-hexa was not affected after toxin exposure, nor toxin proteins directly induced degranulation. It has been shown that ERK inhibitors and cAMP-elevating agents suppress BMMCs degranulation[32,33]. The similar effects of LT and ET on MC degranulation may be linked to their intracellular target, MEK1/2 and cAMP respectively. These results also suggest that mast cells should have nothing to do with the vascular leakage caused by LT and ET.

One interesting finding of this study was that LT inhibits BMMCs mitochondria SDH activity. A previous study has reported that they observed a continuous drop of MTT signal in LT-treated murine J774A.1 macrophages and suggested that it is caused by cell SDH inhibition [34]. Actually, the drop of MTT signal in J774A.1 macrophages following LT exposure may be mainly due to the rapid cell necrosis. Our studies indicated that BMMCs do not undergo rapid death following LT exposure. Furthermore, the similar effects of LT on MTS signaling was linked to their intracellular target, MEK3/6, as suggested by the P38 inhibitor-induced drop of MTS signaling. It is the first report about bacterial virulence factors inhibits host cell mitochondria SDH activity. This observation leads to questions about the role of SDH inhibition in anthrax infection. Mammilian succinate dehydrogenase is a key component of the electron transfer chain of mitochondria, it catalyses the oxidation of succinate into fumarate in the Krebs cycle [35]. It is possible that SDH inhibition could reduce the ATP production in cells. In future studies, we plan to address the question of the effect of SDH inhibition on cell function by investigating the effect of SDH inhibition on cell function with SDH specific inhibitors.

During anthrax infection, both LT and ET were physiologically secreted. One feature of this study is the investigation of the effects of both of them. Our results show that LT and ET have shared roles in some aspects, while they play opposite roles in other aspects. LT/ET combinatorial effects in vivo should be dependent on actual relevant doses of each toxin during infection.

In summary, the present study demonstrates the distinct, shared and opposite roles for LT and ET on mast cell viability, cytokine/chemokine production, degranulation, CCL-5 production and SDH activity. Most importantly, we provide the first demonstration that LT and ET oppositely modulate mast cell CCL-5 production and SDH activity. These findings reveal a new level complexity for immune modulation function of anthrax toxins. Further study will focus on the roles of these toxin-mediated opposite effects in the infection establishment and pathology of anthrax.

Funding: This work was supported by grants from XXXXX, The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing Interests: The authors have declared that no competing interests exist.